Detection of Helicobacter pylori and its associated host signals in vitro

https://doi.org/10.33263/BioMed22.075085

Sondos Hamdy ¹, Nasser H. Abass ¹, Khalid Bassiouny ¹ and Hany Khalil ^1,*

¹   Department of Molecular Biology, University of Sadat City, Sadat City, Egypt; sondoshamdy93@yahoo.com; husseingenelab@yahoo.com; khbassiouny@yahoo.com

*  Correspondence: hkhalil74@gmail.com; Scopus ID: 35738922700

Abstract

Background: Helicobacter pylori (H. pylori) is one of the most common pathogens that can colonize and present in human gastric mucosa causing various gastrointestinal diseases. Methods: we were interested to determine the presence of H.pylori in the native-collection tap water that was contaminated with sewage by polymerase chain reaction (PCR) using specific primer for H. pylori – 16SrRNA. Further, quantitative real time- PCR (qRT-PCR) was used for the detection of H. pylori replication in HeLa cells using specific oligonucleotides for its 16SrRNA indicated by the relative gene expression. Results: Our results showed that most of the collected tap water samples revealed the same amplified fragment of 16SrRNA and the same fingerprint in PCR assay when compared with genomic DNA isolated from standard H. Pylori strain. Furthermore, the in vitro studying of H. pylori infection in HeLa cells showed high production levels of lactate dehydrogenase (LDH) from infected cells indicating the cytotoxic effect of H. pylori infection. Additionally, the relative expression of the Raf-1, autophagy-related Atg5, and PI3K were markedly increased in response to H. pylori infection in HeLa cells. Furthermore, H. pylori infection showed an obvious regulation of the production of the pro-inflammatory cytokines including IL-6 and TNF-α in a time-dependent manner. Conclusion: our data here provide sufficient evidences for the detection of  H. pylori particles either in obtained samples or within the infected cell lines and highlight the potential cell signaling associated with H. pylori replication in vitro.

Keywords: Helicobacter pylori, molecular diagnostic, HeLa cells, cell signaling, cytokines.

1. Introduction

Helicobacter pylori (H. pylori) is a Gram-negative bacterium that colonizes the gastric mucosa and infects more than 50% of the world’s population [1].Long term H. pylori infection leads to serious injury in the gastric mucosa causing a variety of associated syndromes, such as chronic gastritis, peptic ulcer, gastric cancer, and gastric mucosa-associated lymphoid tissue (MALT) lymphoma  [2]. Usually, H. pylori is transmitted person-to-person by saliva or by fecal-contaminated food and water. Noteworthy, in the developing countries, H. pylori prevalence occurred during childhood by a combination of several factors including contaminated water, crowded conditions, and poor hygiene [3,4]. Several diagnostic tests are used to determine H. pylori infection, including blood test, breath test, stool test, and scope test. Analysis of a blood sample may reveal evidence of an active or previous H. pylori infection. However, breath and stool tests are more accurate for detecting active H. pylori infections than a blood test. During a breath test, the tagged carbon molecules are used to swallow which releases detectable carbon molecules in the presence of H. pylori in the stomach. The stool test is an antigen test based on the interaction between specific antigen and associated H. pylori protein in the stool. The scope test is known as an upper endoscopy exam required sedated-patients to use endoscope which facilitates investigation of the upper digestive tract and collect tissue samples (biopsy) for further investigations [5]. Indeed, polymerase chain reaction (PCR) is a highly recommended assay to investigate the occurrence of bacterial infection and determination of bacterial replication in a variety of clinical biopsies and environmental samples [6]. Typically, H. pylori infects the body through the mouth, then transfers through the digestive system to infect the stomach or the first part of the small intestine. The flagellated bacterium can move around and burrow into the stomach lining, which stimulates the secretion of the pro-inflammatory cytokines [4]. Unlike other bacteria, H. pylori infection leads to overproduction of somatic acid in which it can survive by producing urease that neutralizes stomach acid. Furthermore, the produced ammonia  has a harmful cytotoxic effect on human cells [4,7]. Since H. pylori has been classified as a class one carcinogenic pathogen and one of the critical risk factors for ulcer diseases and gastric cancer, it is likely that early diagnosis of H. pylori infection plays a protective role in cancer initiation and development [8]. Accordingly, raising attention has focused on the bacterial-host interaction and the alteration of cellular signaling associated with H. pylori infection [7]. Noteworthy, H. pylori can interact with more than forty host protein receptors via its type IV secretion systems (T4SS), such as cluster of differentiation 18 (CD18), CD46, CD74, E-cadherin, fibronectin, laminin, T-cell receptor, Toll-like receptors, and receptor tyrosine kinases EGFR. The bacterial T4SS includes serious proteins and effectors such as CagL, CagI, CagY, and CagA that can modulate cellular immune response to support bacterial vacuolation and intracellular replication [9,10]. In addition, H. pylori infection activates the intracellular receptors NOD1, NOD2, and NLRP3 with crucial impact in cellular immune response and pro-inflammatory cytokines secretion [11,12]. Further, H. pylori increases the DNA methylation of many genes in gastric epithelial cells suggesting the role of bacterial infection in the epigenetics alteration of the host genes that support cancer initiation [13]. Recent evidence indicates that H. pylori infection induces cellular autophagy via the bacterial effector VacA, however the endoplasmic reticulum (ER) stress and lysosomal inhibition by bacterial proteins stimulates the autophagy-induced cell death [14]. Cellular autophagy is the evolutionarily conserved machinery which depends on the lysosomal-catabolic degradation of cellular macromolecules and organelles engulfed by the autophagosomes and degraded by lysosomal-fusion [15–17]. The autophagic machinery is activated due to the exogenous environmental stress and the intracellular damages with the main purpose to maintain cell survival. The interruption of any stage of autophagy process including pre-autophagy, autophagosomes formation, and lysosomal-fusion leads to the initiation of the programmed cell death (PCD).  In the current study, we sought to establish an accurate method to detect H. pylori in contaminated water and infected cells in vitro using the real time-PCR (RT-PCR) and specific oligonucleotides for 16SrRNA. Moreover, we tested the alteration of some host gene expression following H. pylori infectionassociated with cell proliferation and survival maintenance such as Raf-1, PI3K, and autophagy-related Atg5.  Finally, we monitored the concentration of the pro-inflammatory cytokines produced upon H. pylori infection in HeLa cells including IL-1α, IL-1β, IL-6, and TNF-α.

2. Materials and Methods

2.1. Samples collection and genomic DNA isolation

The contaminated tap water samples were collected from different provinces in Egypt. To isolate the genomic DNA from the organic contents, the samples were centrifuged for 10 minutes at 5000 rpm using 15 ml falcon tubes, then the supernatant was removed. DNA lysis buffer was added to the pellet on each sample, then the genomic DNA purification kit (Thermo Fisher, USA) was used to isolate and purify the genomic DNA. The concentration of isolated DNA has been measured by the NanoDrop and the final concentration has been adjusted to be 1 µg/µl.

2.2. Cell line

The cervical cancer cell line, HeLa cells (VACSERA, Egypt), was cultured in RPMI medium supplement with 4 mM l-glutamine and 10% fetal bovine serum (FBS) in a humidified 5% CO₂ atmosphere at 37°C. HeLa cells were seeded in 6-well tissue culture plates at a density of 2×10⁵ and were grown to 90% confluency. At two hours before infection, the medium was replaced by fresh medium containing 0.5% FBS, and the cells were allowed to grow for two hours pre-infection [18,19]. Finally, the bacteria were added to the cells for the indicated time points.

2.3. Bacterial strain and infection protocol

H. pylori strains P12 (wild type, USA) were cultured on agar plates containing 10% horse serum under microaerophilic conditions at 37°C and 10% CO₂ for five days. Then, the Brucella broth liquid medium supplemented with 10% (v/v) heat-inactivated FBS was used to culture and grow H. pylori in a liquid media as previously described [20]. Different aliquots of the grown H. pylori in the liquid media have been stored at -80°C. For the in vitro infection, the bacteria were harvested from culture plates in Dulbecco’s phosphate-buffered saline (PBS) (pH 7.4) and the concentration of bacteria was measured using mass spectrophotometer by optical density at 600 nm, corresponding 1.0 is approximately equal  1×10⁸ colony forming units (CFU)/mL [21]. The bacterial stock was added to the HeLa cells at different multiplicities of infection (MOI of 1, 5, and 10) for 6, 12, 24, 48, and 72h. As controls, PBS was incubated with the cells for the same time points. During infection, cells were monitored using an inverted microscope [22,23].

2.4. Cell viability and cytotoxic effects

Count and imaging of living cells upon infection have been used as indicators for cell viability rate at each time point. Assessing of lactate dehydrogenase (LDH) released into the media of infected cells has been used as an indicator of the potential cytotoxic effect of H. pylori infection on HeLa cells. The LDH assay kit (Ambion, USA) was used to assess the production level of LDH upon infection. According to the manufacture procedures, 10 µl of each sample was incubated with 40 µl LDH assay buffer for 10 minutes, then 2 µl LDH substrate was added, and LDH was measured immediately at OD 450nm in a microplate reader. The relative LDH production was calculated by dividing the mean absorbance values of the samples on the mock absorbance values which resulted in the fold change of LDH production [19,24].

2.5. Total RNA isolation and cDNA synthesis

Total RNAs were isolated from HeLa cells using TriZol (Invitrogen, USA) and chloroform and were purified by using RNA isolation kit (Invitrogen, USA). The purified total RNA was dissolved in RNase-free water and the concentration of all samples was adjusted to the final concentration of 100ng/ul. Then, the cDNA synthesis kit (Qiagen, USA) was used to generate the cDNA by using 15 µl from the purified RNA. According to the manufacturer protocol, total RNA was incubated with dNTPs, reverse transcriptase, and oligo (dT) primers at 45°C for one hour followed by 5 minutes at 95°C. The cDNA was then used for RT-PCR analysis and conventional PCR investigations.

2.6. Conventional PCR assay

The purified genomic DNA from contaminated water was used to amplify the 16SrRNA specific segment (250 nucleotides in length) using the specific primer sequences F: 5′- TCGGAATCA CTGGGCGTAA -3′ and R: 5′- TTCTATGGTTAAGCCATAGGATTTCAC-3′. The following reagents have been prepared for each reaction; 15 µl PCR master mix, 100 ng of genomic DNA, 10 pmol from each premier (1 µl) and finally the total volume was adjusted to 25 µl with RNase- and DNase-free water. PCR was carried out in AmpGene DNA thermal cycler and the following PCR parameters were used: the initial denaturation step (94°C for 5 min), then 40 cycles (94°C for 30sec, 60°C for 20sec and 72°C for 30sec). Finally, the PCR product has been electrophoresed on 1% agarose gel for 30 min and monitored by gel documentation system [25].

2.7. Quantitative RT-PCR investigation

Quantitative RT-PCR (qRT-PCR) was used to detect the relative expression of H. pylori-16SrRNA, Raf-1, Atg5, and PI3K genes to investigate both bacterial replication and cellular immune response in infected HeLa cells. The resulting cDNA was used as template for subsequent PCR amplification using primers specific for one gene. The relative gene expression of the indicated genes were detected using the QuantiTect SYBR Green PCR Kit (Qiagen, USA) and oligonucleotides specific for each individual gene, Raf-For-5´- TTTCCTGGATCATGTTCCCCT -3´, Raf-Rev-5´- ACTTTGGTGCTACAGTGCTCA -3´ [26], Atg5-1-For-5´- CGTGTATGAAAGAAGCTGATGC -3´, Atg5-Rev-5´- ACGAAATCCATTTTCTTCTGGA -3  [27], and PI3K-For-5´- TGCTGAACCCTATTGGTG -3´, PI3K-Rev-5´- TACAGTCCAGAAGCTCCA -3 [28]. Levels of GAPDH were amplified using specific oligonucleotides, GAPDH-For-5′-TGGCATTGTGGAAGGGCTCA-3′ and GAPDH-Rev-5′-TGGATGCAGGGATGATGTTCT-3′ [16], which was used for normalization as internal control. The following parameters have been used in RT-PCR program, 94°C for 5 min, 40 cycles (94°C for 30 seconds, 58°C for 30 seconds, and 72°C for 30 seconds) and held at 4°C. The indicated Ct values have been analyzed using ∆∆Ct equations [29,30].

2.8. Enzyme-linked immunosorbent assay

For quantitative measurement of secreted interleukins, sandwich enzyme-linked immunosorbent assay (ELISA) was used to determine the concentrations of IL-1β, IL-1α, IL-6 and TNF-α in the fluid media of infected cells. The human ELISA kits (Abcam, 46052), (Abcam, 46028), (Abcam, 46042), and (Abcam, 181421) have been used to detect the indicated cytokines, respectively. Accordingly, HeLa cells were seeded and incubated overnight in 96-well plates, at a density of 2×10⁴ cells per well. The cells were infected with H. Pylori, MOI of 10 and were incubated for different time points (0, 6, 12, 24, 48, and 72 hours). The infected cells were then lysed and transferred into the ELISA-96-well plate followed incubation at 37ºC for 4 hours. The media was then removed, and the cells were washed using PBS, then 100 µl of the antibody solution was added to each well followed by one-hour incubation at RT. Then, 200 µl of the substrate was added to each well followed by 15 minutes incubation away from the light at RT. Finally, the reaction was stopped by adding 50 µl from stop solution and the intensity of the color  was measured at 450 nm [31–33].

2.9. Agarose gel electrophoresis

The conventional PCR products were loaded in 1% agarose gel which has been prepared by dissolving 1 g agarose in 50 ml TAE (1X) in a graduated cylinder and then was transferred into the agarose flask. The top of the flask was covered with a paper towel and was boiled at microwave until completely milt. 10 µl of the ethidium bromide was added to the warm gel which then was poured to the DNA electrophoresis cassette and left to be cold. After loading the samples onto the gel, the electrophoresis was carried out using 50 V for one hour [25].

2.10. Statistical analysis

The qRT-PCT data analysis was performed by driving the ∆∆Ct values using the following equations; (Delta Ct) = Ct-gene – Ct-GAPDH. (∆∆Ct) = ∆Ct-sample – ∆Ct- control. Finally, the relative gene expression (indicated by fold change) is equal (2-ΔΔct) [29,34].

3. Results and Discussion

3.1. H. pylori infection induces cytotoxic alteration in HeLa cells

To investigate the potential cytotoxic effect of H. pylori in infected HeLa cells, the number of living cells and representative cell image have monitored in infected cells. Additionally, LDH production from infected cells has been measured to investigate the possible cytotoxic effects following infection. Therefore, HeLa cells were seeded in 6-well plate in concentration of 2 × 10⁵ cells per well followed by overnight incubation at CO₂ incubator. HeLa cells were infected with different MOI of H. pylori (1, 5, 10 MOI) followed by 2 days incubation. Expectedly, H. pylori infection showed an obvious cytotoxic effect in HeLa indicated by apoptotic cell images and decreased number of living cells, approximately 0.5 fold change in day 1 and 2.5 fold change in day 2 (Figure 1A and B). Further, LDH production was measured as an indicator for cytotoxic alteration in infected and non-infected cells. Noteworthy, LDH is an enzyme that converts lactic acid to pyruvic acid in Krebs’s cycle. Importantly, LDH is found in mitochondria of all living and its secretion has toxic effect that stimulates PCD. Here, the level of LDH production was increased up to 3 fold changes in day 1 following infection and 4 fold changes in day 2 that further confirms the cytotoxic influence of H. pylori infection on cell proliferation (Figure 1C). These findings indicate that H. pylori infection stimulates PCD in infected HeLa cells.

3.2. Detection of H. pylori using reverse transcriptase and RT-PCR

Based on the differentiation of 16SrRNA in different pathogens, we designed new specific oligonucleotides for H. pylori-16SrRNA to figure out bacterial replication in infected cells using RT-PCR. Meanwhile, by using the same created primer, the expected amplified fragment from H. pylori-genomic DNA is almost 300 nucleotides in length using reverse transcriptase PCR. Total RNA was first isolated and purified from infected HeLa cells and has been loaded in agarose gel to verify the purification of both 16SrRNA and 18SrRNA (Figure 2A). For RT-PCR analysis, total RNA has been isolated and purified from HeLa cells that were infected for 2 days with the indicated MOI of the H. pylori. The relative gene expression of 16SrRNA was detected in infected cells and was normalized to the infected cells with MO1=1 (1X). The results revealed that the relative expression of H. pylori –16SrRNA was gradually increased in a dose-dependent manner of H. pylori infection when compared with the lower infection (Figure 2B). Furthermore, by using purified DNA, the expression of H. Pylori-16SrRNA in contaminated water has been successfully recognized in the agarose gel using conventional PCR when compared with the standard strain of H. pylori (Figure 2C). These data indicate that our established method using specific primer for H. pylori-16SrRNA is sufficient to detect and confirm the presence and replication of H. pylori in infected cells and contaminated water samples, respectively.

3.3. H. pylori infection stimulates the expression of cell proliferation genes

HeLa cells were seeded in 6-well plate with a density of 2×10⁵cells/well and were infected with H. pylori, MOI of 10 for 2 days.  The relative gene expression of Raf-1 and Atg5, and PI3K in infected HeLa cells was quantified by using q-RT-PCR and normalized to non-infected cells. Interestingly, the relative expression of Raf-1 was significantly increased (up to 5-fold) in infected HeLa cells in comparison with the control-cells (Figure 3A). Likewise, the relative expression of the autophagy-related Atg5 was increased up to 8 fold changes in infected cells compared with non-infected cells (Figure 3B). Furthermore, the steady state mRNA of PI3K was increased more than 2 fold changes as a response to H. pylori infection when compared with non-infected cells (Figure 3C). Together, these data suggest the increasing levels of the steady state mRNA of Raf-1, autophagy-related Atg5, and PI3K as a response to H. pylori infection in HeLa cells.

3.4. H. pylori infection increases production of IL-6 and TNF-α from infected HeLa

To achieve the time-dependent competence of the H. pylori infection on the secretion of the pro-inflammatory cytokines, HeLa cells were seeded in 96-well plate and were incubated for different time points at 6, 12, 24, 48, and 72 hours following infection. Then, the pro-inflammatory cytokine secretion, including levels of produced IL-1α, IL-1β, IL-6, and TNF-α was monitored in the fluid media of infected cells. The results showed that the concentration of both IL-1α and IL-1β were comparable in both infected and non-infected cells during all different time points (Figure 4A and B). In contradictory with this, the concentration of produced IL-6 and TNF-α were increased in a time-dependent manner following infection (Figure 4C and D). Collectively, these findings indicate that H. pylori infection regulates the production of the pro-inflammatory cytokines in a time-dependent manner to overcome the cellular immune response of neighboring non-infected cells.

In the current work, we successfully established an accurate method using both the conventional and RT-PCR.to detect and recognize H. pylori in contaminated water and infected HeLa cells by specific oligonucleotides for the H. pylori 16SrRNA.Furthermore, we investigated the relative gene expression and cytokines secretion associated with H. pylori infection in vitro. Interestingly, our findings confirm the possible identification of H. pylori in contaminated water using the  purified genomic DNA which revealed a specific fragment with a molecular size of about 250 base pairs, when amplified with the primers specific for H. pylori-16SrRNA. Moreover, the relative expression of cell proliferation and cell survival genes including Raf-1, Atg5, and PI3K was markedly increased upon H. pylori infection in HeLa cells suggesting the possible impact of H. pylori in maintaining cell survival following infection to avoid the cytotoxic effects of bacterial vacuolation. Meanwhile, the cytotoxic effects of H. pylori infection have been monitored dependent on the levels of secreted LDH from infected cells. The present data reveal that LDH production is increased in time-dependent following H. pylori infection as a result of mitochondrial stress and oxidative stress (hypoxia). H. pylori-induced mitochondrial stress has been recently reported through the regulatory function of its VacA effector which increases mitochondrial dysfunctional and hypoxia [35]. Noteworthy, the bacterial-induced oxidative stress is one of the recognized mechanism by which H. pylori activates apoptotic signaling in the late stage of infection [36]. LDH is one of the hypoxia biochemical parameters that reveal the oxidative stress condition by increasing levels of its extracellular activity. LDH is an enzyme located in mitochondria in all living cells responsible for the conversion of lactate to pyruvic acid during the Krebs cycle. Importantly, the secretion of LDH refers to a systemic toxic effect on cell proliferation that induces PCD [31,37,38]. The patients with chronic infection of H. pylori showed high production levels of the pro-inflammatory cytokines IL-17 and IL-23 [39]. The children infected with H. pylori showed increasing levels of the pro-inflammatory cytokines IL-6, IL-10, IFN-γ, TNF-α, at both RNA and protein levels [40]. Similarly, long-term infection with H. pylori triggers the pro-inflammatory cytokines IL-1β, as a key mediator of many pathogen-physiological events and reveals host-environment interactions [41]. Likewise, our findings further confirm that the cytotoxic effects of H. pylori infection may be started in day 2 following infection indicated by the high production levels of LDH and the pro-inflammatory cytokines IL-6 and TNF-α. The increased production levels of both IL-1α and IL-β were not detectable until day 3 following infection, indicating the sequence of the cytokines secretion events from infected cells. Conversely, in the early stage of infection, H. pylori activates in vitro cell proliferation signals including the mitogen‐activated protein kinases (MAPK), nuclear factor-κB (NF-κB ), and the activator protein 1 (AP-)1 in a dose-dependent manner [42,43]. The immediate activation of the cell survival pathway PI3K/AKT signaling has been reported following H. pylori infection in maintaining gastric cancer cells [44].

Furthermore, the bacterial effector, VacA has been identified as an efficacious regulator of the mammalian target of rapamycin complex 1 (mTORC1) which resulted in activation of autophagy and preventing PCD [45]. Likely, we demonstrated the over-expression of some regulator genes in infected HeLa cells including the expression of Raf-1, as an indicator for MAPK signal, Atg5, as an indicator for autophagy process, and PI3K as an indicator for the cell survival pathway PI3K/AKT. Therefore, the present data coincide with the previous findings indicating that H. pylori infection activates the cell survival signaling following infection to support the intracellular replication and to avoid the apoptotic signaling with a minimum cytotoxic response. In the late stage of infection H. pylori stimulates the apoptotic signaling and triggers the production of the pro-inflammatory cytokines to overcome the cellular immune response of the neighboring cells.

4. Conclusions

We established an accurate and sensitive method to detect H. pylori in the contaminated water via isolation of the genomic DNA from collected samples and amplification of the purified DNA with specific primers for the H. pylori-16SrRNA. Intracellular replication of H. pylori has been also successfully monitored using the same oligonucleotides in infected HeLa cells. The investigation of cellular signaling associated with H. pylori infection further confirms the ability of H. pylori to maintain cell survival and to avoid apoptotic signaling following infection. Furthermore, the cytotoxic effect of the H. pylori infection was detected at day 2 of the infection indicated by an increased level of LDH, IL-6, and TNF-α in vitro.

References

1. Huang Y, Cheng D, Lu N, Wang Q, Xu W. Adhesion and Invasion of Gastric Mucosa Epithelial Cells by Helicobacter pylori. Front Cell Infect Microbiol 2016;6. http://doi.org/10.3389/fcimb.2016.00159.
2. Khoder G, Muhammad J, Mahmoud I, Soliman S, Burucoa C. Prevalence of Helicobacter pylori and Its Associated Factors among Healthy Asymptomatic Residents in the United Arab Emirates. Pathogens 2019;8:44. http://doi.org/10.3390/pathogens8020044.
3. Kayali S, Manfredi M, Gaiani F, Bianchi L, Bizzarri B, Leandro G, et al. Helicobacter pylori, transmission routes and recurrence of infection: state of the art. Acta Biomed 2018;89:72–6. http://doi.org/10.23750/abm.v89i8-S.7947.
4. Brown LM. Helicobacter Pylori: Epidemiology and Routes of Transmission. Epidemiol Rev 2000;22:283–97. http://doi.org/10.1093/oxfordjournals.epirev.a018040.
5. Wang Y-K, Kuo F-C, Liu C-J, Wu M-C, Shih H-Y, Wang SSW, et al. Diagnosis of Helicobacter pylori infection: Current options and developments. World J Gastroenterol 2015;21:11221–35. http://doi.org/10.3748/wjg.v21.i40.11221.
6. Saez J, Belda S, Santibáñez M, Rodríguez JC, Sola-Vera J, Galiana A, et al. Real-time PCR for diagnosing Helicobacter pylori infection in patients with upper gastrointestinal bleeding: comparison with other classical diagnostic methods. J Clin Microbiol 2012;50:3233–7. http://doi.org/10.1128/JCM.01205-12.
7. Robinson K, Argent RH, Atherton JC. The inflammatory and immune response to Helicobacter pylori infection. Best Pract Res Clin Gastroenterol 2007. http://doi.org/10.1016/j.bpg.2007.01.001.
8. Israel DA, Salama N, Arnold CN, Moss SF, Ando T, Wirth HP, et al. Helicobacter pylori strain-specific differences in genetic content, identified by microarray, influence host inflammatory responses. J Clin Invest 2001;107:611–20. http://doi.org/10.1172/JCI11450.
9. Pachathundikandi SK, Tegtmeyer N, Backert S. Signal transduction of Helicobacter pylori during interaction with host cell protein receptors of epithelial and immune cells. Gut Microbes 2013;4:454–74. http://doi.org/10.4161/gmic.27001.
10. Posselt G, Backert S, Wessler S. The functional interplay of Helicobacter pylori factors with gastric epithelial cells induces a multi-step process in pathogenesis. Cell Commun Signal 2013;11:77. http://doi.org/10.1186/1478-811X-11-77.
11. Kim D-J, Park J-H, Franchi L, Backert S, Núñez G. The Cag pathogenicity island and interaction between TLR2/NOD2 and NLRP3 regulate IL-1β production in Helicobacter pylori infected dendritic cells. Eur J Immunol 2013;43:2650–8. http://doi.org/10.1002/eji.201243281.
12. Naumann M. Host cell signaling in Helicobacter pylori infection. Int J Med Microbiol 2001;291:299–305. http://doi.org/10.1078/1438-4221-00133.
13. Sue S, Shibata W, Maeda S. Helicobacter pylori-Induced Signaling Pathways Contribute to Intestinal Metaplasia and Gastric Carcinogenesis. Biomed Res Int 2015;2015:737621. http://doi.org/10.1155/2015/737621.
14. Zhu P, Xue J, Zhang Z, Jia Y, Tong Y, Han D, et al. Helicobacter pylori VacA induces autophagic cell death in gastric epithelial cells via the endoplasmic reticulum stress pathway. Cell Death Dis 2017;8:3207. http://doi.org/10.1038/s41419-017-0011-x.
15. Khalil H. The Intracellular Signalling that Associated with Influenza a Virus Infection. Pediatr Infect Dis 2017;1:38. http://doi.org/10.21767/2573-0282.100038.
16. Abd El Maksoud AI, Elebeedy D, Abass NH, Awad AM, Nasr GM, Roshdy T, et al. Methylomic Changes of Autophagy-Related Genes by Legionella Effector Lpg2936 in Infected Macrophages. Front Cell Dev Biol 2020;7:390. http://doi.org/10.3389/fcell.2019.00390.
17. Khalil H, Abd El Maksoud AI, Alian A, El-Hamady WA, Daif AA, Awad AM, et al. Interruption of Autophagosome Formation in Cardiovascular Disease, an Evidence for Protective Response of Autophagy. Immunol Invest 2020;49:249–63. http://doi.org/10.1080/08820139.2019.1635619.
18. Karlas A, Machuy N, Shin Y, Pleissner K-P, Artarini A, Heuer D, et al. Genome-wide RNAi screen identifies human host factors crucial for influenza virus replication. SUPPLEMENTARY INFO. Nature 2010;463:818–22. http://doi.org/10.1038/nature08760.
19. Khalil H, El Malah T, El Maksoud AIA, El Halfawy I, El Rashedy AA, El Hefnawy M. Identification of novel and efficacious chemical compounds that disturb influenza A virus entry in vitro. Front Cell Infect Microbiol 2017. http://doi.org/10.3389/fcimb.2017.00304.
20. Blanchard TG, Nedrud JG. Laboratory maintenance of helicobacter species. Curr Protoc Microbiol 2006;Chapter 8:Unit8B.1-Unit8B.1. http://doi.org/10.1002/9780471729259.mc08b01s00.
21. Jung SW, Thamphiwatana S, Zhang L, Obonyo M. Mechanism of antibacterial activity of liposomal linolenic acid against Helicobacter pylori. PLoS One 2015;10:e0116519–e0116519. http://doi.org/10.1371/journal.pone.0116519.
22. Schneider S, Carra G, Sahin U, Hoy B, Rieder G, Wessler S. Complex cellular responses of Helicobacter pylori-colonized gastric adenocarcinoma cells. Infect Immun 2011;79:2362–71. http://doi.org/10.1128/IAI.01350-10.
23. Poppe M, Feller SM, Römer G, Wessler S. Phosphorylation of Helicobacter pylori CagA by c-Abl leads to cell motility. Oncogene 2007;26:3462–72. http://doi.org/10.1038/sj.onc.1210139.
24. Khalil H, Abd El Maksoud AI, Roshdey T, El-Masry S. Guava flavonoid glycosides prevent influenza A virus infection via rescue of P53 activity. J Med Virol 2019;91:45–55. http://doi.org/10.1002/jmv.25295.
25. Dahb Hassen, Bassiouny K, El-Shenawy F, Khalil H. Epigenetics Reprogramming of Autophagy is involved in Childhood Acute Lymphatic Leukemia 2017:1–6. http://doi.org/10.21767/2573-0282.100045.
26. Abd El Maksoud AI, Taher RF, Gaara AH, Abdelrazik E, Keshk OS, Elawdan KA, et al. Selective Regulation of B-Raf Dependent K-Ras/Mitogen-Activated Protein by Natural Occurring Multi-kinase Inhibitors in Cancer Cells. Front Oncol 2019;9:1220. http://doi.org/10.3389/fonc.2019.01220.
27. Khalil H, Abd El Maksoud AI, Alian A, El-Hamady WA, Daif AA, Awad AM, et al. Interruption of Autophagosome Formation in Cardiovascular Disease, an Evidence for Protective Response of Autophagy. Immunol Invest 2019:1–15. http://doi.org/10.1080/08820139.2019.1635619.
28. Campos M, Kool MMJ, Daminet S, Ducatelle R, Rutteman G, Kooistra HS, et al. Upregulation of the PI3K/Akt pathway in the tumorigenesis of canine thyroid carcinoma. J Vet Intern Med 2014;28:1814–23. http://doi.org/10.1111/jvim.12435.
29. Schmittgen TD, Jiang J, Liu Q, Yang L. A high-throughput method to monitor the expression of microRNA precursors. Nucleic Acids Res 2004;32:e43. http://doi.org/10.1093/nar/gnh040.
30. Farghaly H, Guirgis A, Khalil H. Heat shock reduces HCV replication via regulation of ribosomal L22 in Alu-RNA molecule dependent manner. Hepatoma Res 2018;4.
31. Khalil H, Maksoud AIA El, Roshdey T, El‐Masry S. Guava flavonoid glycosides prevent influenza A virus infection via rescue of P53 activity. J Med Virol 2018. http://doi.org/10.1002/jmv.25295.
32. Khalil H, Abd El Maksoud AI, Alian A, El-Hamady WA, Daif AA, Awad AM, et al. Interruption of Autophagosome Formation in Cardiovascular Disease, an Evidence for Protective Response of Autophagy. Immunol Invest 2019:1–15. http://doi.org/10.1080/08820139.2019.1635619.
33. Khalil H, Arfa M, El-Masrey S, EL-Sherbini S, Abd-Elaziz A. Single nucleotide polymorphisms of interleukins associated with hepatitis C virus infection in Egypt. J Infect Dev Ctries 2017;11:261–8. http://doi.org/10.3855/jidc.8127.
34. Khalil H, Tazi M, Caution K, Ahmed A, Kanneganti A, Assani K, et al. Aging is associated with hypermethylation of autophagy genes in macrophages. Epigenetics 2016;11:381–8. http://doi.org/10.1080/15592294.2016.1144007.
35. Chatre L, Fernandes J, Michel V, Fiette L, Avé P, Arena G, et al. Helicobacter pylori targets mitochondrial import and components of mitochondrial DNA replication machinery through an alternative VacA-dependent and a VacA-independent mechanisms. Sci Rep 2017;7:15901. http://doi.org/10.1038/s41598-017-15567-3.
36. Calvino-Fernández M, Benito-Martínez S, Parra-Cid T. Oxidative stress by Helicobacter pylori causes apoptosis through mitochondrial pathway in gastric epithelial cells. Apoptosis 2008;13:1267–80. http://doi.org/10.1007/s10495-008-0255-0.
37. Jovanovic P, Zoric L, Stefanovic I, Dzunic B, Djordjevic-Jocic J, Radenkovic M, et al. Lactate dehydrogenase and oxidative stress activity in primary open-angle glaucoma aqueous humour. Bosn J Basic Med Sci 2010;10:83–8. http://doi.org/10.17305/bjbms.2010.2743.
38. Tauffenberger A, Fiumelli H, Almustafa S, Magistretti PJ. Lactate and pyruvate promote oxidative stress resistance through hormetic ROS signaling. Cell Death Dis 2019;10:653. http://doi.org/10.1038/s41419-019-1877-6.
39. Arachchi PS, Fernando N, Weerasekera MM, Senevirathna B, Weerasekera DD, Gunasekara CP. Proinflammatory Cytokine IL-17 Shows a Significant Association with Helicobacter pylori Infection and Disease Severity. Gastroenterol Res Pract 2017;2017:6265150. http://doi.org/10.1155/2017/6265150.
40. Michalkiewicz J, Helmin-Basa A, Grzywa R, Czerwionka-Szaflarska M, Szaflarska-Poplawska A, Mierzwa G, et al.  Innate Immunity Components and Cytokines in Gastric Mucosa in Children with Helicobacter pylori Infection . Mediators Inflamm 2015. http://doi.org/10.1155/2015/176726.
41. El-Omar EM. The importance of interleukin 1β inHelicobacter pylori associated disease. Gut 2001;48:743–7. http://doi.org/10.1136/gut.48.6.743.
42. Ding S-Z, Smith Jr MF, Goldberg JB. Helicobacter pylori and mitogen-activated protein kinases regulate the cell cycle, proliferation and apoptosis in gastric epithelial cells. J Gastroenterol Hepatol 2008;23:e67–78. http://doi.org/10.1111/j.1440-1746.2007.04912.x.
43. Allison CC, Kufer TA, Kremmer E, Kaparakis M, Ferrero RL. Helicobacter pylori Induces MAPK Phosphorylation and AP-1 Activation via a NOD1-Dependent Mechanism. J Immunol 2009. http://doi.org/10.4049/jimmunol.0900664.
44. Xu W, Huang Y, Yang Z, Hu Y, Shu X, Xie C, et al. Helicobacter pylori promotes gastric epithelial cell survival through the PLK1/PI3K/Akt pathway. Onco Targets Ther 2018;11:5703–13. http://doi.org/10.2147/OTT.S164749.
45. Kim I-J, Lee J, Oh SJ, Yoon M-S, Jang S-S, Holland RL, et al. Helicobacter pylori Infection Modulates Host Cell Metabolism through VacA-Dependent Inhibition of mTORC1. Cell Host Microbe 2018;23:583-593.e8. http://doi.org/10.1016/j.chom.2018.04.006.